Stem-loop sequence zma-MIR159g

AccessionMI0013187 (change log)
DescriptionZea mays miR159g stem-loop
Gene family MIPF0000010; MIR159
Literature search

30 open access papers mention zma-MIR159g
(150 sentences)

Stem-loop
   aguuugauucacuagaccugauccccuagacuagacggucuggucuuaag    u           a    uaaa        cu  -u   -   ua     g    u     guuc    ugu        aucagagagagagaagauc 
5'                                                   gcgg gcucccuucac ccaa    cggucgau  ga  ggg ugg  cagcu cucg ucaug    ccac   cccaucuc                   a
                                                     |||| ||||||||||| ||||    ||||||||  ||  ||| |||  ||||| |||| |||||    ||||   ||||||||                    
3'                                                   cguc ugagggaagug gguu    gccaguug  cu  ccc gcu  gucga gagc aguac    ggug   ggguagag                   u
   --------------------------------------------------    u           a    uguc        --  uc   u   cc     g    c     guuu    uuc        uucguagagagcgagagag 
Get sequence
Deep sequencing
1432 reads, 1.17e+03 reads per million, 171 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence zma-miR159g-5p

Accession MIMAT0015311
Previous IDszma-miR159g*
Sequence

54 - 

gugcucccuucacaccaauaa

 - 74

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence zma-miR159g-3p

Accession MIMAT0013976
Previous IDszma-miR159g
Sequence

231 - 

uuuggagugaagggaguucug

 - 251

Get sequence
Deep sequencing552 reads, 131 experiments
Evidence experimental; Illumina [1]

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).