Stem-loop sequence zma-MIR159f

AccessionMI0013186 (change log)
DescriptionZea mays miR159f stem-loop
Gene family MIPF0000010; MIR159
Literature search

31 open access papers mention zma-MIR159f
(155 sentences)

Stem-loop
   --        uc   u     u  ag  u  uuc  aa    -   u c   g    u     guuc    uau         uccauguuugcgugucuucgagagga 
5'   ggagcucc  uca uccaa ga  gg cc   cg  gggu ggu c gcu cucg ucaug    ccac   ccuaucuca                          a
     ||||||||  ||| ||||| ||  || ||   ||  |||| ||| | ||| |||| |||||    ||||   |||||||||                           
3'   ucucgagg  agu agguu cu  cc gg   gu  ccca cca g cga gagc aguac    ggug   ggauagagu                          g
   cg        ga   u     u  cg  -  -uc  gc    g   c u   g    c     guuu    uuc         uuuccgcugguguccuuagagaaggc 
Get sequence
Deep sequencing
11923 reads, 4.44e+03 reads per million, 203 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr3: 25007834-25008048 [-]
intergenic
Database links

Mature sequence zma-miR159f-5p

Accession MIMAT0015310
Previous IDszma-miR159f*
Sequence

2 - 

gagcuccucucauuccaauga

 - 22

Get sequence
Deep sequencing7 reads, 3 experiments
Evidence experimental; Illumina [1]

Mature sequence zma-miR159f-3p

Accession MIMAT0013975
Previous IDszma-miR159f
Sequence

194 - 

uuuggauugaagggagcucug

 - 214

Get sequence
Deep sequencing10032 reads, 195 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).