Stem-loop sequence zma-MIR159e

AccessionMI0013185 (change log)
DescriptionZea mays miR159e stem-loop
Literature search

31 open access papers mention zma-MIR159e
(153 sentences)

Stem-loop
   -- c       -g   c   u  ucga    c    c  u   a     -    agcgcaaguccg 
5'   g agcuccu  cag auc gu    ggcu gccg gu cug ugauc cggc            g
     | |||||||  ||| ||| ||    |||| |||| || ||| ||||| ||||            c
3'   c ucgaggg  guu ugg ua    ccgg cggc cg ggc gcugg gccg            g
   ca c       aa   -   u  --ug    u    -  c   g     a    gcggcggcagcg 
Get sequence
Deep sequencing
15459 reads, 1.24e+04 reads per million, 215 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr1: 249664337-249664463 [-]
intergenic
Database links

Mature sequence zma-miR159e-5p

Accession MIMAT0015309
Previous IDszma-miR159e*
Sequence

2 - 

cagcuccugcagcaucuguuc

 - 22

Get sequence
Evidence not experimental

Mature sequence zma-miR159e-3p

Accession MIMAT0013974
Previous IDszma-miR159e
Sequence

106 - 

auugguuugaagggagcucca

 - 126

Get sequence
Deep sequencing322 reads, 110 experiments
Evidence not experimental

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).