Stem-loop sequence zma-MIR156l

AccessionMI0013184 (change log)
DescriptionZea mays miR156l stem-loop
Gene family MIPF0000008; MIR156
Literature search

51 open access papers mention zma-MIR156l
(338 sentences)

Stem-loop
   --        -    -         a      g cgga       cgg 
5'   gugacaga agag agugagcac cggccg g    acggcac   c
     |||||||| |||| ||||||||| |||||| |    |||||||    
3'   cacugucu ucuc ucacucgug gccggc c    ugccgug   g
   cc        a    g         c      g ----       uag 
Get sequence
Deep sequencing
236163 reads, 2.72e+04 reads per million, 210 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr5: 188595332-188595421 [-]
intergenic
Database links

Mature sequence zma-miR156l-5p

Accession MIMAT0013973
Previous IDszma-miR156l
Sequence

2 - 

ugacagaagagagugagcac

 - 21

Get sequence
Deep sequencing203931 reads, 40 experiments
Evidence experimental; Illumina [1]

Mature sequence zma-miR156l-3p

Accession MIMAT0015308
Previous IDszma-miR156l*
Sequence

68 - 

gcucacugcucuaucugucacc

 - 89

Get sequence
Deep sequencing146 reads, 14 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).