Stem-loop sequence ssc-mir-125b-1

AccessionMI0013172 (change log)
DescriptionSus scrofa miR-125b-1 stem-loop
Gene family MIPF0000033; mir-10
Literature search

23 open access papers mention ssc-mir-125b-1
(161 sentences)

Stem-loop
   ----c   u   uc  ug   c           au     c 
5'      cuc cag  cc  aga ccuaacuugug  guuua c
        ||| |||  ||  ||| |||||||||||  ||||| g
3'      gag guc  gg  ucu ggauugggcac  uaaau u
   gugcc   c   ga  gu   c           -c     u 
Get sequence
Deep sequencing
14873 reads, 3.62e+03 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr9: 54334908-54334987 [-]
intergenic
Database links

Mature sequence ssc-miR-125b

Accession MIMAT0002120
Sequence

9 - 

ucccugagacccuaacuuguga

 - 30

Get sequence
Deep sequencing26891 reads, 15 experiments
Evidence experimental; Illumina [1-3]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
3
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).