Stem-loop sequence ssc-mir-505

AccessionMI0013171 (change log)
DescriptionSus scrofa miR-505 stem-loop
Gene family MIPF0000217; mir-505
Literature search

3 open access papers mention ssc-mir-505
(4 sentences)

Stem-loop
   --  a u   u           g    a        -u  g 
5'   gc c cag gggggagccag aagu uugauguu  cu c
     || | ||| ||||||||||| |||| ||||||||  ||  
3'   cg g guc cuccuuugguc uuca aacugcga  gg c
   ua  a -   u           g    c        uu  a 
Get sequence
Deep sequencing
569 reads, 7.14 reads per million, 14 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chrX: 130835642-130835721 [-]
intergenic
Database links

Mature sequence ssc-miR-505

Accession MIMAT0013961
Sequence

50 - 

ucaacacuugcugguuuccucu

 - 71

Get sequence
Deep sequencing547 reads, 14 experiments
Evidence experimental; Illumina [1-3]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
3
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).