Stem-loop sequence ssc-mir-455

AccessionMI0013170 (change log)
DescriptionSus scrofa miR-455 stem-loop
Gene family MIPF0000129; mir-455
Literature search

4 open access papers mention ssc-mir-455
(6 sentences)

Stem-loop
   --   c ug  g          u      a   c   gaa 
5'   ugg g  ag guaugugccu uggacu cau gug   g
     ||| |  || |||||||||| |||||| ||| |||    
3'   acu c  uc cauauacggg accuga gua cac   c
   ga   c gu  a          u      c   c   gac 
Get sequence
Deep sequencing
1571 reads, 33.3 reads per million, 15 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr1: 286017379-286017458 [+]
sense
ENSSSCT00000020360 ; ssc-mir-455.1-201; exon 1
ENSSSCT00000006033 ; COL27A1-201; intron 10
antisense
chrUScaf1770: 75366-75445 [+]
sense
ENSSSCT00000020360 ; ssc-mir-455.1-201; exon 1
ENSSSCT00000006033 ; COL27A1-201; intron 10
antisense
Database links

Mature sequence ssc-miR-455-5p

Accession MIMAT0022957
Sequence

12 - 

uaugugccuuuggacuacaucg

 - 33

Get sequence
Deep sequencing979 reads, 15 experiments
Evidence experimental; Illumina [2]

Mature sequence ssc-miR-455-3p

Accession MIMAT0013960
Previous IDsssc-miR-455
Sequence

50 - 

gcaguccaugggcauauacac

 - 70

Get sequence
Deep sequencing592 reads, 15 experiments
Evidence experimental; Illumina [1-3]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
3
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).