Stem-loop sequence ssc-mir-769

AccessionMI0013168 (change log)
DescriptionSus scrofa miR-769 stem-loop
Gene family MIPF0000727; mir-769
Literature search

1 open access papers mention ssc-mir-769
(1 sentences)

Stem-loop
   ugc       c ug       u   u   g    gu  ug 
5'    gcucuga c  agaccuc ggg ucu agcu  ga  u
      ||||||| |  ||||||| ||| ||| ||||  ||  u
3'    ugggacu g  ucugggg cuc agg ucga  cu  g
   ---       u gu       u   u   g    ac  uc 
Get sequence
Deep sequencing
532 reads, 0 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr6: 47579825-47579904 [+]
sense
ENSSSCT00000023153 ; CCDC8-201; intron 1
chr6: 47708761-47708840 [+]
sense
ENSSSCT00000023153 ; CCDC8-201; intron 1
Database links

Mature sequence ssc-miR-769-5p

Accession MIMAT0020363
Sequence

13 - 

ugagaccucuggguucugagc

 - 33

Get sequence
Deep sequencing489 reads, 15 experiments
Evidence experimental; Illumina [2-3]

Mature sequence ssc-miR-769-3p

Accession MIMAT0013958
Previous IDsssc-miR-769
Sequence

52 - 

cugggaucucuggggucuugguu

 - 74

Get sequence
Deep sequencing42 reads, 9 experiments
Evidence experimental; Illumina [1-3]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
3
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).