Stem-loop sequence ssc-mir-500

AccessionMI0013166 (change log)
DescriptionSus scrofa miR-500 stem-loop
Gene family MIPF0000139; mir-500
Literature search

3 open access papers mention ssc-mir-500
(7 sentences)

Stem-loop
   ----ccc     -u         uac ug    agag   ugu 
5'        cucuc  aauccuugc   c  ggug    ugc   g
          |||||  |||||||||   |  ||||    |||   u
3'        gagag  uuaggaacg   g  ccac    acg   g
   cgagagu     uc         --- gu    -gua   uaa 
Get sequence
Deep sequencing
1232 reads, 20 reads per million, 15 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chrX: 48637994-48638073 [+]
intergenic
Clustered miRNAs
< 10kb from ssc-mir-500
ssc-mir-532chrX: 48632025-48632104 [+]
ssc-mir-500chrX: 48637994-48638073 [+]
ssc-mir-362chrX: 48638466-48638544 [+]
ssc-mir-660chrX: 48640821-48640889 [+]
Database links

Mature sequence ssc-miR-500-5p

Accession MIMAT0037369
Sequence

9 - 

uaauccuugcuaccugggugaga

 - 31

Get sequence
Deep sequencing317 reads, 15 experiments
Evidence experimental; Illumina [4]

Mature sequence ssc-miR-500-3p

Accession MIMAT0013956
Sequence

48 - 

augcaccugggcaaggauucu

 - 68

Get sequence
Deep sequencing915 reads, 15 experiments
Evidence experimental; Illumina [1,3], cloned [2]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
3
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).
4
PMID:25230983 "The characteristics of the porcine (Sus scrofa) liver miRNAome with the use of next generation sequencing" Pawlina K, Gurgul A, Oczkowicz M, Bugno-Poniewierska M J Appl Genet. 56:239-252(2015).