Stem-loop sequence ssc-mir-1285

AccessionMI0013164 (change log)
DescriptionSus scrofa miR-1285 stem-loop
Gene family MIPF0000579; mir-1273
Literature search

2 open access papers mention ssc-mir-1285
(4 sentences)

Stem-loop
   gcugauc  u  -    a  g   c    aaua   ---a   u 
5'        ag ag uggg uc cgc ugug    gcc    cug a
          || || |||| || ||| ||||    |||    ||| c
3'        uc uc gccc ag gcg auac    cgg    gac u
   ---guuu  -  u    c  a   -    --aa   gucc   c 
Get sequence
Deep sequencing
1664 reads, 14.3 reads per million, 14 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr1: 199694416-199694495 [-]
sense
ENSSSCT00000026398 ; Metazoa_SRP.8-201; exon 1
ENSSSCT00000031702 ; Metazoa_SRP.17-201; exon 1
chr1: 200102137-200102216 [+]
sense
ENSSSCT00000026398 ; Metazoa_SRP.8-201; exon 1
ENSSSCT00000031702 ; Metazoa_SRP.17-201; exon 1
Database links

Mature sequence ssc-miR-1285

Accession MIMAT0013954
Sequence

49 - 

cugggcaacauagcgagaccccgu

 - 72

Get sequence
Deep sequencing1221 reads, 14 experiments
Evidence experimental; Illumina [1-2]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).