Stem-loop sequence ssc-mir-628

AccessionMI0013163 (change log)
DescriptionSus scrofa miR-628 stem-loop
Gene family MIPF0000529; mir-628
Stem-loop
   guguca      ca  -   a   a             aaag 
5'       cuuccu  ug cug cau uuuacuagagggu    u
         ||||||  || ||| ||| |||||||||||||     
3'       gaaggg  gc gac gug gaaugaucuucca    u
   -----g      aa  u   g   a             acaa 
Get sequence
Deep sequencing
225 reads, 0 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr1: 129013474-129013553 [+]
sense
ENSSSCT00000005091 ; CCPG1-201; intron 1
Database links

Mature sequence ssc-miR-628-5p

Accession MIMAT0013953
Sequence

14 - 

augcugacauauuuacuagagg

 - 35

Get sequence
Deep sequencing199 reads, 12 experiments
Evidence experimental; Illumina [1-2]

Mature sequence ssc-miR-628-3p

Accession MIMAT0037368
Sequence

52 - 

ucuaguaagaguggcagucgaag

 - 74

Get sequence
Deep sequencing26 reads, 8 experiments
Evidence experimental; Illumina [3]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
3
PMID:25230983 "The characteristics of the porcine (Sus scrofa) liver miRNAome with the use of next generation sequencing" Pawlina K, Gurgul A, Oczkowicz M, Bugno-Poniewierska M J Appl Genet. 56:239-252(2015).