Stem-loop sequence ssc-mir-1839

AccessionMI0013162 (change log)
DescriptionSus scrofa miR-1839 stem-loop
Gene family MIPF0000702; mir-1839
Literature search

1 open access papers mention ssc-mir-1839
(6 sentences)

Stem-loop
   --ccuaaaugaaaa      u   ac        uuug a 
5'               gguaga aga  aggucuug    c a
                 |||||| |||  ||||||||    | g
3'               ccaucu uuu  uccagaac    g a
   cacauuaacgacaa      -   ca        uuaa u 
Get sequence
Deep sequencing
37 reads, 0 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr7: 57683204-57683283 [-]
sense
ENSSSCT00000022181 ; SCARNA15.2-201; exon 1
Database links

Mature sequence ssc-miR-1839-5p

Accession MIMAT0013952
Previous IDsssc-miR-1839
Sequence

11 - 

aagguagauagaacaggucuug

 - 32

Get sequence
Deep sequencing33 reads, 11 experiments
Evidence experimental; Illumina [1-4]

Mature sequence ssc-miR-1839-3p

Accession MIMAT0017385
Sequence

50 - 

agaccuacuuuucuaccaaca

 - 70

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [2-4]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:20433717 "Deciphering the porcine intestinal microRNA transcriptome" Sharbati S, Friedlander MR, Sharbati J, Hoeke L, Chen W, Keller A, Stahler PF, Rajewsky N, Einspanier R BMC Genomics. 11:275(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
4
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).