Stem-loop sequence ssc-mir-19b-1

AccessionMI0013160 (change log)
DescriptionSus scrofa miR-19b-1 stem-loop
Gene family MIPF0000011; mir-19
Literature search

17 open access papers mention ssc-mir-19b-1
(31 sentences)

Stem-loop
   cuguu                 -  -      uc    ugugu 
5'      cuaugguuaguuuugca gg uuugca  cagc     g
        ||||||||||||||||| || ||||||  ||||     a
3'      ggugucagucaaaacgu cc aaacgu  gucg     u
   -----                 a  u      --    ucuua 
Get sequence
Deep sequencing
26400 reads, 5.37e+03 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr11: 66610642-66610721 [+]
sense
ENSSSCT00000021497 ; ssc-mir-19b-1.1-201; exon 1
Clustered miRNAs
< 10kb from ssc-mir-19b-1
ssc-mir-17chr11: 66610060-66610136 [+]
ssc-mir-18achr11: 66610195-66610286 [+]
ssc-mir-19achr11: 66610343-66610424 [+]
ssc-mir-20achr11: 66610513-66610583 [+]
ssc-mir-19b-1chr11: 66610642-66610721 [+]
ssc-mir-92a-1chr11: 66610762-66610841 [+]
Database links

Mature sequence ssc-miR-19b

Accession MIMAT0013950
Sequence

52 - 

ugugcaaauccaugcaaaacuga

 - 74

Get sequence
Deep sequencing57472 reads, 15 experiments
Evidence experimental; Illumina [1,3-4], cloned [2]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
4
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).