Stem-loop sequence ssc-mir-19b-2

AccessionMI0013159 (change log)
DescriptionSus scrofa miR-19b-2 stem-loop
Gene family MIPF0000011; mir-19
Literature search

15 open access papers mention ssc-mir-19b-2
(29 sentences)

Stem-loop
   --                -  -      uuu    g      u 
5'   uacaguuaguuuugca gg uuugca   cagc uaugua g
     |||||||||||||||| || ||||||   |||| ||||||  
3'   guguuagucaaaacgu cc aaacgu   gucg guauau u
   ua                a  u      ---    -      g 
Get sequence
Deep sequencing
31131 reads, 9.55e+03 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chrX: 126199650-126199729 [-]
intergenic
Clustered miRNAs
< 10kb from ssc-mir-19b-2
ssc-mir-106achrX: 126200183-126200263 [-]
ssc-mir-18bchrX: 126200019-126200101 [-]
ssc-mir-20b-1chrX: 126199775-126199854 [-]
ssc-mir-19b-2chrX: 126199650-126199729 [-]
ssc-mir-92a-2chrX: 126199512-126199591 [-]
ssc-mir-363-1chrX: 126199347-126199426 [-]
Database links

Mature sequence ssc-miR-19b

Accession MIMAT0013950
Sequence

51 - 

ugugcaaauccaugcaaaacuga

 - 73

Get sequence
Deep sequencing57472 reads, 15 experiments
Evidence experimental; Illumina [1,3-4], cloned [2]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
3
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).