Stem-loop sequence ssc-mir-328

AccessionMI0013158 (change log)
DescriptionSus scrofa miR-328 stem-loop
Gene family MIPF0000203; mir-328
Literature search

4 open access papers mention ssc-mir-328
(4 sentences)

Stem-loop
   --          -------     ga     u     a aaa  g 
5'   ggagcggggg       ggcag  ggggc caggg g   gu u
     ||||||||||       |||||  ||||| ||||| |   ||  
3'   ccuugccccc       ccguc  ucccg guccc c   cg g
   gu          ugccuuc     uc     -     - -gc  u 
Get sequence
Deep sequencing
61 reads, 0 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr6: 25134077-25134156 [-]
antisense
ENSSSCT00000003084 ; ELMO3-201; intron 13
Database links

Mature sequence ssc-miR-328

Accession MIMAT0013949
Sequence

47 - 

cuggcccucucugcccuuccgu

 - 68

Get sequence
Deep sequencing59 reads, 12 experiments
Evidence experimental; Illumina [1-3]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
3
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).