Stem-loop sequence ssc-mir-432

AccessionMI0013155 (change log)
DescriptionSus scrofa miR-432 stem-loop
Gene family MIPF0000211; mir-432
Literature search

6 open access papers mention ssc-mir-432
(11 sentences)

Stem-loop
   -        u     ua       g     a   uu   uu 
5'  uccagguc uggag  ggucauu ggugg ucc  uau  c
    |||||||| |||||  ||||||| ||||| |||  |||   
3'  agguucgg accuc  ucgguag ucacc ggg  gua  c
   g        u     -c       g     -   -u   uc 
Get sequence
Deep sequencing
12 reads, 0 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr7: 132079003-132079082 [+]
intergenic
Clustered miRNAs
< 10kb from ssc-mir-432
ssc-mir-493chr7: 132069400-132069482 [-]
ssc-mir-432chr7: 132079003-132079082 [+]
ssc-mir-136chr7: 132079194-132079275 [+]
Database links

Mature sequence ssc-miR-432-5p

Accession MIMAT0013946
Previous IDsssc-miR-432
Sequence

7 - 

ucuuggaguaggucauugggu

 - 27

Get sequence
Deep sequencing12 reads, 8 experiments
Evidence experimental; Illumina [1-3]

Mature sequence ssc-miR-432-3p

Accession MIMAT0017384
Sequence

56 - 

uggauggcuccuccauggcu

 - 75

Get sequence
Evidence experimental; Illumina [2-3]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:20433717 "Deciphering the porcine intestinal microRNA transcriptome" Sharbati S, Friedlander MR, Sharbati J, Hoeke L, Chen W, Keller A, Stahler PF, Rajewsky N, Einspanier R BMC Genomics. 11:275(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).