Stem-loop sequence ssc-mir-708

AccessionMI0013154 (change log)
DescriptionSus scrofa miR-708 stem-loop
Gene family MIPF0000397; mir-708
Literature search

6 open access papers mention ssc-mir-708
(17 sentences)

Stem-loop
   ---     a           a     c  g ----g   aau 
5'    cccuc aggagcuuaca ucuag ug g     gug   g
      ||||| ||||||||||| ||||| || |     |||   a
3'    gggag ucuucgagugu agauc ac c     cac   c
   gac     a           c     a  g aagua   guu 
Get sequence
Deep sequencing
5804 reads, 433 reads per million, 15 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr9: 15120477-15120556 [-]
intergenic
Database links

Mature sequence ssc-miR-708-5p

Accession MIMAT0013945
Previous IDsssc-miR-708
Sequence

6 - 

aaggagcuuacaaucuagcuggg

 - 28

Get sequence
Deep sequencing5182 reads, 15 experiments
Evidence experimental; Illumina [1-3]

Mature sequence ssc-miR-708-3p

Accession MIMAT0017383
Sequence

52 - 

caacuagacugugagcuucuaga

 - 74

Get sequence
Deep sequencing608 reads, 12 experiments
Evidence experimental; Illumina [2-3]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:20433717 "Deciphering the porcine intestinal microRNA transcriptome" Sharbati S, Friedlander MR, Sharbati J, Hoeke L, Chen W, Keller A, Stahler PF, Rajewsky N, Einspanier R BMC Genomics. 11:275(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).