Stem-loop sequence ssc-mir-342

AccessionMI0013153 (change log)
DescriptionSus scrofa miR-342 stem-loop
Gene family MIPF0000190; mir-342
Literature search

2 open access papers mention ssc-mir-342
(9 sentences)

Stem-loop
   ----       -      --ua      acuga      ugg g 
5'     aagguga gggugc    ucugug     gggaca   c c
       ||||||| ||||||    ||||||     ||||||   | a
3'     uuccacu cccacg    agacac     cucugu   g u
   ccgg       g      cuaa      ----a      caa a 
Get sequence
Deep sequencing
680 reads, 20 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssc-miR-342

Accession MIMAT0013944
Sequence

48 - 

ucucacacagaaaucgcacccguca

 - 72

Get sequence
Deep sequencing664 reads, 15 experiments
Evidence experimental; Illumina [1-2]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).