Stem-loop sequence ssc-mir-532

AccessionMI0013150 (change log)
DescriptionSus scrofa miR-532 stem-loop
Gene family MIPF0000113; mir-188
Literature search

6 open access papers mention ssc-mir-532
(10 sentences)

Stem-loop
   uugcuuu       a  u      a    a   cc  ugg a 
5'        cucucuu ca gccuug gugu gga  gu   c u
          ||||||| || |||||| |||| |||  ||   |  
3'        gggagga gu cggaac caca ccu  ca   g c
   ------c       c  u      c    c   cc  uaa u 
Get sequence
Deep sequencing
2148 reads, 233 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chrX: 48632025-48632104 [+]
intergenic
Clustered miRNAs
< 10kb from ssc-mir-532
ssc-mir-532chrX: 48632025-48632104 [+]
ssc-mir-500chrX: 48637994-48638073 [+]
ssc-mir-362chrX: 48638466-48638544 [+]
ssc-mir-660chrX: 48640821-48640889 [+]
Database links

Mature sequence ssc-miR-532-5p

Accession MIMAT0013940
Sequence

16 - 

caugccuugaguguaggaccgu

 - 37

Get sequence
Deep sequencing2004 reads, 15 experiments
Evidence experimental; Illumina [1-2]

Mature sequence ssc-miR-532-3p

Accession MIMAT0013941
Sequence

52 - 

ccucccacacccaaggcuugca

 - 73

Get sequence
Deep sequencing142 reads, 12 experiments
Evidence experimental; Illumina [1-2]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).