Stem-loop sequence ssc-mir-339-1

AccessionMI0013149 (change log)
Previous IDsssc-mir-339
DescriptionSus scrofa miR-339-1 stem-loop
Gene family MIPF0000193; mir-339
Literature search

7 open access papers mention ssc-mir-339-1
(7 sentences)

Stem-loop
   ----    c   c u c   u    c          uua c 
5'     gcag cgc g c cug ccuc aggagcucac   c u
       |||| ||| | | ||| |||| ||||||||||   |  
3'     cguc gug c g gac ggag uccucgagug   g u
   ucuc    u   c c a   c    c          ccg g 
Get sequence
Deep sequencing
7285 reads, 553 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr3: 726710-726789 [+]
sense
ENSSSCT00000008278 ; C7orf50-201; intron 1
Database links

Mature sequence ssc-miR-339-5p

Accession MIMAT0013939
Previous IDsssc-miR-339
Sequence

11 - 

ucccuguccuccaggagcucac

 - 32

Get sequence
Deep sequencing7266 reads, 15 experiments
Evidence experimental; Illumina [1,3-5], cloned [2]

Mature sequence ssc-miR-339-3p

Accession MIMAT0017381
Sequence

48 - 

agcuccucgaggccagagccc

 - 68

Get sequence
Deep sequencing16 reads, 9 experiments
Evidence experimental; Illumina [3-5]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
3
PMID:20433717 "Deciphering the porcine intestinal microRNA transcriptome" Sharbati S, Friedlander MR, Sharbati J, Hoeke L, Chen W, Keller A, Stahler PF, Rajewsky N, Einspanier R BMC Genomics. 11:275(2010).
4
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
5
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).