Stem-loop sequence ssc-mir-1277

AccessionMI0013146 (change log)
DescriptionSus scrofa miR-1277 stem-loop
Gene family MIPF0001937; mir-1277
Stem-loop
   u    uc     u            g        ug au 
5'  agcc  ccaaa auauauauauau uacguaug  u  a
    ||||  ||||| |||||||||||| ||||||||  |   
3'  uugg  gguuu uauguauauaua augcauau  a  u
   u    gu     u            g        gu ag 
Get sequence
Deep sequencing
26 reads, 0 reads per million, 7 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssc-miR-1277

Accession MIMAT0013935
Sequence

49 - 

uacguagauauauauguauuuu

 - 70

Get sequence
Deep sequencing5 reads, 4 experiments
Evidence experimental; Illumina [1-2]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).