Stem-loop sequence ssc-mir-361

AccessionMI0013145 (change log)
DescriptionSus scrofa miR-361 stem-loop
Gene family MIPF0000172; mir-361
Literature search

4 open access papers mention ssc-mir-361
(52 sentences)

Stem-loop
   ---------     uu         --u  a    u    auaa 
5'          ggagc  aucagaauc   cc gggg acuu    u
            |||||  |||||||||   || |||| ||||    u
3'          cuucg  uagucuuag   gg cccc ugaa    u
   cuccuccuc     uu         ugu  a    c    aaag 
Get sequence
Deep sequencing
6046 reads, 1.26e+03 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chrX: 78804780-78804859 [-]
sense
OTTSUST00000011698 ; CHM-004; intron 3
OTTSUST00000011695 ; CHM-003; intron 8
OTTSUST00000011696 ; CHM-001; intron 9
ENSSSCT00000035906 ; CHM-003; intron 3
ENSSSCT00000013630 ; CHM-201; intron 7
ENSSSCT00000034355 ; CHM-001; intron 8
ENSSSCT00000034932 ; CHM-002; intron 9
Database links

Mature sequence ssc-miR-361-5p

Accession MIMAT0013933
Sequence

6 - 

uuaucagaaucuccagggguac

 - 27

Get sequence
Deep sequencing5918 reads, 15 experiments
Evidence experimental; Illumina [1-3]

Mature sequence ssc-miR-361-3p

Accession MIMAT0013934
Sequence

45 - 

cccccaggugugauucugauuugc

 - 68

Get sequence
Deep sequencing128 reads, 15 experiments
Evidence experimental; Illumina [1-3]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
3
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).