Stem-loop sequence ssc-mir-127

AccessionMI0013144 (change log)
DescriptionSus scrofa miR-127 stem-loop
Gene family MIPF0000080; mir-127
Literature search

13 open access papers mention ssc-mir-127
(47 sentences)

Stem-loop
   aucg   ucu      ugcug         g  c      --  a 
5'     cug   ccagcc     aagcucaga gg ucugau  uc g
       |||   ||||||     ||||||||| || ||||||  || a
3'     ggc   ggucgg     uucgagucu cc aggcua  ag a
   ----   --u      -----         g  u      cu  a 
Get sequence
Deep sequencing
233 reads, 0 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr7: 132099553-132099632 [+]
antisense
ENSSSCT00000002858 ; ssc-mir-127.1-201; exon 2
chrUScaf3120: 17247-17326 [-]
antisense
ENSSSCT00000002858 ; ssc-mir-127.1-201; exon 2
Database links

Mature sequence ssc-miR-127

Accession MIMAT0013932
Sequence

53 - 

ucggauccgucugagcuuggcu

 - 74

Get sequence
Deep sequencing210 reads, 15 experiments
Evidence experimental; Illumina [1-3]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
3
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).