Stem-loop sequence ssc-mir-331

AccessionMI0013142 (change log)
DescriptionSus scrofa miR-331 stem-loop
Gene family MIPF0000199; mir-331
Literature search

4 open access papers mention ssc-mir-331
(26 sentences)

Stem-loop
   uugu       u        u    u       au ccaga 
5'     uuggguu guucuagg augg cccaggg  c     u
       ||||||| |||||||| |||| |||||||  |     c
3'     aauccaa caagaucc uauc ggguccc  g     a
   ----       c        -    c       cg accaa 
Get sequence
Deep sequencing
731 reads, 20 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr5: 92224978-92225057 [-]
intergenic
Database links

Mature sequence ssc-miR-331-5p

Accession MIMAT0013929
Sequence

15 - 

ucuagguauggucccagggau

 - 35

Get sequence
Deep sequencing210 reads, 15 experiments
Evidence experimental; Illumina [1-3]

Mature sequence ssc-miR-331-3p

Accession MIMAT0013930
Sequence

51 - 

gccccugggccuauccuagaa

 - 71

Get sequence
Deep sequencing521 reads, 15 experiments
Evidence experimental; Illumina [1-3]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
3
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).