Stem-loop sequence ssc-mir-195

AccessionMI0013141 (change log)
DescriptionSus scrofa miR-195 stem-loop
Gene family MIPF0000006; mir-15
Literature search

9 open access papers mention ssc-mir-195
(21 sentences)

Stem-loop
   cagcccc     cucua         -a          ccg   g 
5'        ccugg     gcagcacag  aauauuggca   ggc g
          |||||     |||||||||  ||||||||||   ||| a
3'        ggacc     cgucguguc  uuaugaccgu   cug g
   -----ac     ----c         gg          ---   a 
Get sequence
Deep sequencing
3583 reads, 773 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr12: 54717315-54717394 [+]
intergenic
Clustered miRNAs
< 10kb from ssc-mir-195
ssc-mir-497chr12: 54717025-54717104 [+]
ssc-mir-195chr12: 54717315-54717394 [+]
Database links

Mature sequence ssc-miR-195

Accession MIMAT0013928
Sequence

16 - 

uagcagcacagaaauauuggc

 - 36

Get sequence
Deep sequencing3576 reads, 15 experiments
Evidence experimental; Illumina [1,3], cloned [2]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).