Stem-loop sequence ssc-mir-450b

AccessionMI0013140 (change log)
DescriptionSus scrofa miR-450b stem-loop
Gene family MIPF0000128; mir-450
Literature search

5 open access papers mention ssc-mir-450b
(7 sentences)

Stem-loop
   --------        uuu     u       ug -    gua 
5'         aaaauuau   ugcaa auguucc  a auau   a
           ||||||||   ||||| |||||||  | ||||   u
3'         uuuugaua   acguu uacaagg  u uaug   a
   uagcuaug        ccu     u       gu a    aau 
Get sequence
Deep sequencing
8853 reads, 1.63e+03 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chrUScaf3177: 4358-4437 [+]
intergenic
Clustered miRNAs
< 10kb from ssc-mir-450b
ssc-mir-542chrUScaf3177: 3348-3427 [+]
ssc-mir-450cchrUScaf3177: 4053-4133 [+]
ssc-mir-450achrUScaf3177: 4173-4278 [+]
ssc-mir-450bchrUScaf3177: 4358-4437 [+]
Database links

Mature sequence ssc-miR-450b-5p

Accession MIMAT0013927
Previous IDsssc-miR-450b
Sequence

9 - 

uuuugcaauauguuccugaaua

 - 30

Get sequence
Deep sequencing8795 reads, 15 experiments
Evidence experimental; Illumina [1-3]

Mature sequence ssc-miR-450b-3p

Accession MIMAT0017380
Sequence

46 - 

uugggaacauuuugcauccau

 - 66

Get sequence
Deep sequencing58 reads, 10 experiments
Evidence experimental; Illumina [2-3]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:20433717 "Deciphering the porcine intestinal microRNA transcriptome" Sharbati S, Friedlander MR, Sharbati J, Hoeke L, Chen W, Keller A, Stahler PF, Rajewsky N, Einspanier R BMC Genomics. 11:275(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).