Stem-loop sequence ssc-mir-196b-1

AccessionMI0013137 (change log)
Previous IDsssc-mir-196b
DescriptionSus scrofa miR-196b-1 stem-loop
Gene family MIPF0000031; mir-196
Literature search

13 open access papers mention ssc-mir-196b-1
(32 sentences)

Stem-loop
       uc      uu       u  c           ucca 
5' cugg  ggugau  agguagu uc uguuguuggga    c
   ||||  ||||||  ||||||| || |||||||||||     
3' gacu  ucauua  uccguca ag acgacagcucu    c
       --      cu       c  c           cuuu 
Get sequence
Deep sequencing
19 reads, 0 reads per million, 8 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr18: 49836543-49836622 [+]
sense
ENSSSCT00000021607 ; ssc-mir-196b-2.2-201; exon 1
Database links

Mature sequence ssc-miR-196b-5p

Accession MIMAT0013923
Previous IDsssc-miR-196b
Sequence

14 - 

uagguaguuuccuguuguuggg

 - 35

Get sequence
Deep sequencing38 reads, 8 experiments
Evidence experimental; Illumina [1]

Mature sequence ssc-miR-196b-3p

Accession MIMAT0017379
Sequence

50 - 

cgacagcacgacacugccuuca

 - 71

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:20433717 "Deciphering the porcine intestinal microRNA transcriptome" Sharbati S, Friedlander MR, Sharbati J, Hoeke L, Chen W, Keller A, Stahler PF, Rajewsky N, Einspanier R BMC Genomics. 11:275(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
4
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).