Stem-loop sequence ssc-mir-130b

AccessionMI0013136 (change log)
DescriptionSus scrofa miR-130b stem-loop
Gene family MIPF0000034; mir-130
Literature search

7 open access papers mention ssc-mir-130b
(12 sentences)

Stem-loop
        c    ca       cc         a  guggg  a 
5' gccug cuga  cucuuuc  uguugcacu cu     cc c
   ||||| ||||  |||||||  ||||||||| ||     ||  
3' cggac gacu  gggaaag  guaacguga ga     gg u
        u    ac       ua         c  ----a  g 
Get sequence
Deep sequencing
188 reads, 0 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr14: 53695562-53695641 [-]
intergenic
Database links

Mature sequence ssc-miR-130b-5p

Accession MIMAT0037366
Sequence

12 - 

acucuuucccuguugcacuacu

 - 33

Get sequence
Deep sequencing68 reads, 13 experiments
Evidence experimental; Illumina [5]

Mature sequence ssc-miR-130b-3p

Accession MIMAT0013922
Sequence

50 - 

cagugcaaugaugaaagggcau

 - 71

Get sequence
Deep sequencing120 reads, 14 experiments
Evidence experimental; Illumina [1,3-4], cloned [2]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
4
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).
5
PMID:25230983 "The characteristics of the porcine (Sus scrofa) liver miRNAome with the use of next generation sequencing" Pawlina K, Gurgul A, Oczkowicz M, Bugno-Poniewierska M J Appl Genet. 56:239-252(2015).