Stem-loop sequence ssc-mir-34c-1

AccessionMI0013132 (change log)
Previous IDsssc-mir-34c
DescriptionSus scrofa miR-34c-1 stem-loop
Gene family MIPF0000039; mir-34
Literature search

11 open access papers mention ssc-mir-34c-1
(132 sentences)

Stem-loop
   ---     ag     a   a    a     c      c ga 
5'    agucu  uuacu ggc gugu guuag ugauug u  u
      |||||  ||||| ||| |||| ||||| |||||| |   
3'    uuaga  aaugg ccg caca caauc acuaac a  a
   ggu     aa     a   g    c     -      c aa 
Get sequence
Deep sequencing
33462 reads, 9.4e+03 reads per million, 14 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr9: 44166873-44166952 [-]
intergenic
Database links

Mature sequence ssc-miR-34c

Accession MIMAT0013916
Sequence

13 - 

aggcaguguaguuagcugauugc

 - 35

Get sequence
Deep sequencing65820 reads, 14 experiments
Evidence experimental; Illumina [1-2]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
3
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).