Stem-loop sequence ssc-mir-374b

AccessionMI0013131 (change log)
DescriptionSus scrofa miR-374b stem-loop
Gene family MIPF0000288; mir-374
Literature search

5 open access papers mention ssc-mir-374b
(5 sentences)

Stem-loop
   --------------u    ug au             c       c 
5'                cgga  g  auaauacaaccug uaagugu c
                  ||||  |  ||||||||||||| |||||||  
3'                gccu  u  uauuauguuggac auucacg u
   gcucucgguaucugu    gu ac             u       a 
Get sequence
Deep sequencing
15393 reads, 3.01e+03 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chrX: 67425186-67425265 [-]
sense
ENSSSCT00000020850 ; ssc-mir-374b.1-201; exon 1
Clustered miRNAs
< 10kb from ssc-mir-374b
ssc-mir-374bchrX: 67425186-67425265 [-]
ssc-mir-421chrX: 67425032-67425109 [-]
Database links

Mature sequence ssc-miR-374b-5p

Accession MIMAT0013915
Previous IDsssc-miR-374b
Sequence

9 - 

auauaauacaaccugcuaagug

 - 30

Get sequence
Deep sequencing15104 reads, 15 experiments
Evidence experimental; Illumina [1-4]

Mature sequence ssc-miR-374b-3p

Accession MIMAT0017378
Sequence

39 - 

cuuaucagguuguauuaucauu

 - 60

Get sequence
Deep sequencing289 reads, 14 experiments
Evidence experimental; Illumina [2-3]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:20433717 "Deciphering the porcine intestinal microRNA transcriptome" Sharbati S, Friedlander MR, Sharbati J, Hoeke L, Chen W, Keller A, Stahler PF, Rajewsky N, Einspanier R BMC Genomics. 11:275(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
4
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).