Stem-loop sequence ssc-mir-374a

AccessionMI0013130 (change log)
DescriptionSus scrofa miR-374a stem-loop
Gene family MIPF0000288; mir-374
Literature search

5 open access papers mention ssc-mir-374a
(8 sentences)

Stem-loop
   ------------   c   c                        u 
5'             cau ggc auuauaauacaaccugauaagugu a
               ||| ||| ||||||||||||||||||||||||  
3'             gug cug uaauguuauguuggacuauucacg c
   ccguauauauau   u   u                        a 
Get sequence
Deep sequencing
7988 reads, 1.2e+03 reads per million, 15 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chrX: 67530361-67530440 [-]
intergenic
Clustered miRNAs
< 10kb from ssc-mir-374a
ssc-mir-374achrX: 67530361-67530440 [-]
ssc-mir-545chrX: 67530196-67530274 [-]
Database links

Mature sequence ssc-miR-374a-5p

Accession MIMAT0013913
Previous IDsssc-miR-374a
Sequence

10 - 

uuauaauacaaccugauaagug

 - 31

Get sequence
Deep sequencing6759 reads, 15 experiments
Evidence experimental; Illumina [1-4]

Mature sequence ssc-miR-374a-3p

Accession MIMAT0013914
Previous IDsssc-miR-374a*
Sequence

40 - 

cuuaucagguuguauuguaauu

 - 61

Get sequence
Deep sequencing1229 reads, 15 experiments
Evidence experimental; Illumina [1-3]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:20433717 "Deciphering the porcine intestinal microRNA transcriptome" Sharbati S, Friedlander MR, Sharbati J, Hoeke L, Chen W, Keller A, Stahler PF, Rajewsky N, Einspanier R BMC Genomics. 11:275(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
4
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).