Stem-loop sequence ssc-mir-208b

AccessionMI0013129 (change log)
DescriptionSus scrofa miR-208b stem-loop
Gene family MIPF0000178; mir-208
Literature search

11 open access papers mention ssc-mir-208b
(30 sentences)

Stem-loop
   -------        g          c   cg        cu 
5'        cucucagg aagcuuuuug ucg  uuauguuu  c
          |||||||| |||||||||| |||  ||||||||  a
3'        gggagucu uuuggaaaac agc  aauauaag  u
   gugagac        g          a   ag        cc 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr7: 81071323-81071402 [-]
sense
OTTSUST00000001741 ; MYH7-001; intron 30
ENSSSCT00000035771 ; MYH7-001; intron 30
ENSSSCT00000002271 ; MYH7-201; intron 31
Database links

Mature sequence ssc-miR-208b

Accession MIMAT0013912
Sequence

45 - 

auaagacgaacaaaagguuugu

 - 66

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1-2]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).