Stem-loop sequence ssc-mir-100

AccessionMI0013128 (change log)
DescriptionSus scrofa miR-100 stem-loop
Gene family MIPF0000033; mir-10
Literature search

5 open access papers mention ssc-mir-100
(10 sentences)

Stem-loop
   aggccuguugc    a   cg    uc   a      c  au 
5'            caca acc  uaga  cga cuugug ug  a
              |||| |||  ||||  ||| |||||| ||   
3'            gugu ugg  aucu  guu gaacac ac  g
   -----gugucu    a   au    gu   c      -  gu 
Get sequence
Deep sequencing
121567 reads, 3.02e+04 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr9: 54383382-54383461 [-]
intergenic
Clustered miRNAs
< 10kb from ssc-mir-100
ssc-mir-100chr9: 54383382-54383461 [-]
ssc-let-7a-1chr9: 54378059-54378138 [-]
Database links

Mature sequence ssc-miR-100

Accession MIMAT0013911
Sequence

16 - 

aacccguagauccgaacuugug

 - 37

Get sequence
Deep sequencing121553 reads, 15 experiments
Evidence experimental; Illumina [1,3-4], cloned [2]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
4
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).