Stem-loop sequence ssc-mir-192

AccessionMI0013127 (change log)
DescriptionSus scrofa miR-192 stem-loop
Gene family MIPF0000063; mir-192
Literature search

17 open access papers mention ssc-mir-192
(112 sentences)

Stem-loop
   gca  g g  c         -     a       ugcucuc 
5'    ca g cu ugaccuaug aauug cagccag       a
      || | || ||||||||| ||||| |||||||        
3'    gu u ga acuggauac uuaac gucgguc       u
   ---  a g  c         c     c       uccccuc 
Get sequence
Deep sequencing
198 reads, 0 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr2: 6416980-6417059 [+]
intergenic
Clustered miRNAs
< 10kb from ssc-mir-192
ssc-mir-194achr2: 6416779-6416854 [+]
ssc-mir-192chr2: 6416980-6417059 [+]
Database links

Mature sequence ssc-miR-192

Accession MIMAT0013910
Sequence

11 - 

cugaccuaugaauugacagcc

 - 31

Get sequence
Deep sequencing198 reads, 12 experiments
Evidence experimental; Illumina [1-2]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).