Stem-loop sequence ssc-mir-92b

AccessionMI0013126 (change log)
DescriptionSus scrofa miR-92b stem-loop
Gene family MIPF0000013; mir-25
Literature search

11 open access papers mention ssc-mir-92b
(25 sentences)

Stem-loop
   -gc    g     ga       c            uucuu 
5'    gggc ggagg  cgggacg ggugcaguguug     u
      |||| |||||  ||||||| ||||||||||||     c
3'    cccg ccucc  gcccugc ucacguuauaac     c
   ccc    g     -g       -            cgucc 
Get sequence
Deep sequencing
94 reads, 0 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr4: 103407102-103407181 [-]
intergenic
Database links

Mature sequence ssc-miR-92b-5p

Accession MIMAT0017377
Sequence

10 - 

agggacgggacgcggugcaguguu

 - 33

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [2-4]

Mature sequence ssc-miR-92b-3p

Accession MIMAT0013909
Previous IDsssc-miR-92b
Sequence

51 - 

uauugcacucgucccggccucc

 - 72

Get sequence
Deep sequencing92 reads, 11 experiments
Evidence experimental; Illumina [1-4]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:20433717 "Deciphering the porcine intestinal microRNA transcriptome" Sharbati S, Friedlander MR, Sharbati J, Hoeke L, Chen W, Keller A, Stahler PF, Rajewsky N, Einspanier R BMC Genomics. 11:275(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
4
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).