Stem-loop sequence ssc-mir-664

AccessionMI0013123 (change log)
DescriptionSus scrofa miR-664 stem-loop
Gene family MIPF0000300; mir-664
Literature search

3 open access papers mention ssc-mir-664
(10 sentences)

Stem-loop
   gaacauugaaac     a     ag   u         aa 
5'             aggcu ggaga  uga uggauagaa  u
               ||||| |||||  ||| |||||||||  g
3'             uccga ccucu  auu acuuaucuu  g
   -aaagaaaaaca     c     --   u         au 
Get sequence
Deep sequencing
187 reads, 0 reads per million, 14 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr10: 11890513-11890592 [+]
sense
ENSSSCT00000019903 ; SNORA36.1-201; exon 1
ENSSSCT00000011842 ; RAB3GAP2-201; intron 9
Database links

Mature sequence ssc-miR-664-5p

Accession MIMAT0013906
Sequence

12 - 

caggcuaggagaagugauuggau

 - 34

Get sequence
Deep sequencing83 reads, 13 experiments
Evidence experimental; Illumina [1-3]

Mature sequence ssc-miR-664-3p

Accession MIMAT0013907
Sequence

49 - 

uauucauuuaucucccagccuaca

 - 72

Get sequence
Deep sequencing104 reads, 11 experiments
Evidence experimental; Illumina [1-2]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
3
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).