Stem-loop sequence ssc-mir-365-1

AccessionMI0013121 (change log)
DescriptionSus scrofa miR-365-1 stem-loop
Gene family MIPF0000061; mir-365
Literature search

7 open access papers mention ssc-mir-365-1
(43 sentences)

Stem-loop
   -c    ggaaaaug     c           ----   -   uuu 
5'   gcag        aggga uuuugggggca    gau gug   c
     ||||        ||||| |||||||||||    ||| |||   c
3'   cguu        uuccu aaaauccccgu    cua cac   a
   cu    -------a     a           aaua   u   cuu 
Get sequence
Deep sequencing
414 reads, 6.67 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr3: 29976236-29976315 [-]
sense
ENSSSCT00000020736 ; ssc-mir-365-1.1-201; exon 1
Database links

Mature sequence ssc-miR-365-3p

Accession MIMAT0013904
Previous IDsssc-miR-365
Sequence

54 - 

uaaugccccuaaaaauccuuau

 - 75

Get sequence
Deep sequencing815 reads, 15 experiments
Evidence experimental; Illumina [1-4]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:20433717 "Deciphering the porcine intestinal microRNA transcriptome" Sharbati S, Friedlander MR, Sharbati J, Hoeke L, Chen W, Keller A, Stahler PF, Rajewsky N, Einspanier R BMC Genomics. 11:275(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
4
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).