Stem-loop sequence ssc-mir-365-2

AccessionMI0013120 (change log)
DescriptionSus scrofa miR-365-2 stem-loop
Gene family MIPF0000061; mir-365
Literature search

7 open access papers mention ssc-mir-365-2
(43 sentences)

Stem-loop
   --------aaa        ac   c       -----    u   u 
5'            aaugaggg  uuu aggggca     gcug guu u
              ||||||||  ||| |||||||     |||| |||  
3'            uuauuccu  aaa uccccgu     ugac cag c
   ugacguucuug        aa   -       aauac    u   u 
Get sequence
Deep sequencing
409 reads, 6.67 reads per million, 15 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr12: 45152792-45152871 [-]
intergenic
Database links

Mature sequence ssc-miR-365-5p

Accession MIMAT0017376
Sequence

7 - 

gagggacuuucaggggcagcugu

 - 29

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [2-4]

Mature sequence ssc-miR-365-3p

Accession MIMAT0013904
Previous IDsssc-miR-365
Sequence

47 - 

uaaugccccuaaaaauccuuau

 - 68

Get sequence
Deep sequencing815 reads, 15 experiments
Evidence experimental; Illumina [1-4]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:20433717 "Deciphering the porcine intestinal microRNA transcriptome" Sharbati S, Friedlander MR, Sharbati J, Hoeke L, Chen W, Keller A, Stahler PF, Rajewsky N, Einspanier R BMC Genomics. 11:275(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
4
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).