Stem-loop sequence ssc-mir-885

AccessionMI0013119 (change log)
DescriptionSus scrofa miR-885 stem-loop
Gene family MIPF0000532; mir-885
Literature search

3 open access papers mention ssc-mir-885
(4 sentences)

Stem-loop
   cacucggc   c     c           a  -         cu 
5'         ccg gcucu uccauuacacu cc cugccucuu  c
           ||| ||||| ||||||||||| || |||||||||   
3'         ggc cgaga aggugaugugg gg gacggagag  c
   --------   a     u           -  c         ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssc-miR-885-5p

Accession MIMAT0013902
Sequence

19 - 

uccauuacacuacccugccucu

 - 40

Get sequence
Evidence experimental; Illumina [1,3-5], cloned [2]

Mature sequence ssc-miR-885-3p

Accession MIMAT0013903
Sequence

51 - 

aggcagcgggguguaguggau

 - 71

Get sequence
Evidence experimental; Illumina [1,3-5]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
3
PMID:20433717 "Deciphering the porcine intestinal microRNA transcriptome" Sharbati S, Friedlander MR, Sharbati J, Hoeke L, Chen W, Keller A, Stahler PF, Rajewsky N, Einspanier R BMC Genomics. 11:275(2010).
4
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
5
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).