Stem-loop sequence ssc-mir-99a

AccessionMI0013114 (change log)
DescriptionSus scrofa miR-99a stem-loop
Gene family MIPF0000033; mir-10
Literature search

12 open access papers mention ssc-mir-99a
(34 sentences)

Stem-loop
   -c          a         uc   u      g  aag 
5'   cauuggcaua acccguaga  cga cuugug ug   u
     |||||||||| |||||||||  ||| |||||| ||    
3'   gugacugugu uggguaucu  gcu gaacac gc   g
   gu          c         uc   c      -  cag 
Get sequence
Deep sequencing
134700 reads, 3.22e+04 reads per million, 15 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr13: 191558610-191558689 [+]
sense
ENSSSCT00000021434 ; ssc-mir-99a.1-201; exon 1
Clustered miRNAs
< 10kb from ssc-mir-99a
ssc-mir-99achr13: 191558610-191558689 [+]
ssc-let-7cchr13: 191559336-191559429 [+]
Database links

Mature sequence ssc-miR-99a-5p

Accession MIMAT0013896
Sequence

12 - 

aacccguagauccgaucuugug

 - 33

Get sequence
Deep sequencing134469 reads, 15 experiments
Evidence experimental; Illumina [1,3-4], cloned [2]

Mature sequence ssc-miR-99a-3p

Accession MIMAT0037365
Sequence

49 - 

caagcucgcuucuaugggucu

 - 69

Get sequence
Deep sequencing231 reads, 14 experiments
Evidence experimental; Illumina [5]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
4
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).
5
PMID:25230983 "The characteristics of the porcine (Sus scrofa) liver miRNAome with the use of next generation sequencing" Pawlina K, Gurgul A, Oczkowicz M, Bugno-Poniewierska M J Appl Genet. 56:239-252(2015).