Stem-loop sequence ssc-mir-193a

AccessionMI0013113 (change log)
DescriptionSus scrofa miR-193a stem-loop
Gene family MIPF0000082; mir-193
Literature search

7 open access papers mention ssc-mir-193a
(13 sentences)

Stem-loop
   gcg  a             u     cg   g  a    ggu 
5'    gg gcugagggcuggg cuuug  ggc ag ugag   g
      || ||||||||||||| |||||  ||| || ||||    
3'    cc cggcuccugaccc gaaac  ccg uc acuu   u
   ---  -             u     au   g  a    ggu 
Get sequence
Deep sequencing
151 reads, 0 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr12: 45165038-45165117 [-]
intergenic
Database links

Mature sequence ssc-miR-193a-5p

Accession MIMAT0013894
Sequence

16 - 

ugggucuuugcgggcgagauga

 - 37

Get sequence
Deep sequencing100 reads, 11 experiments
Evidence experimental; Illumina [1,3-4]

Mature sequence ssc-miR-193a-3p

Accession MIMAT0013895
Sequence

50 - 

aacuggccuacaaagucccagu

 - 71

Get sequence
Deep sequencing48 reads, 8 experiments
Evidence experimental; Illumina [1,3-4], cloned [2]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
4
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).