Stem-loop sequence ssc-mir-23b

AccessionMI0013112 (change log)
DescriptionSus scrofa miR-23b stem-loop
Gene family MIPF0000027; mir-23
Literature search

19 open access papers mention ssc-mir-23b
(38 sentences)

Stem-loop
   cuc       u   --          -  c      gugacu 
5'    uggcugc ugg  guuccuggca ug ugauuu      u
      ||||||| |||  |||||||||| || ||||||       
3'    accgacg acc  uagggaccgu ac acuaaa      a
   --c       c   au          u  -      auuaga 
Get sequence
Deep sequencing
14870 reads, 2.59e+03 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr10: 31341114-31341193 [-]
intergenic
Clustered miRNAs
< 10kb from ssc-mir-23b
ssc-mir-23bchr10: 31341114-31341193 [-]
ssc-mir-27bchr10: 31340880-31340959 [-]
ssc-mir-24-2chr10: 31340334-31340413 [-]
Database links

Mature sequence ssc-miR-23b

Accession MIMAT0013893
Sequence

50 - 

aucacauugccagggauuacca

 - 71

Get sequence
Deep sequencing14789 reads, 15 experiments
Evidence experimental; Illumina [1,3-4], cloned [2]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
4
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).