Stem-loop sequence ssc-mir-24-2

AccessionMI0013111 (change log)
DescriptionSus scrofa miR-24-2 stem-loop
Gene family MIPF0000041; mir-24
Literature search

33 open access papers mention ssc-mir-24-2
(81 sentences)

Stem-loop
   gacc  cc    g  g   a         ua     ucuca 
5'     cg  cucc gu ccu cugagcuga  ucagu     u
       ||  |||| || ||| |||||||||  |||||     u
3'     gc  gagg ca gga gacuugacu  gguca     u
   ---a  -u    a  a   c         -c     cacau 
Get sequence
Deep sequencing
17959 reads, 2.78e+03 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr10: 31340334-31340413 [-]
antisense
ENSSSCT00000020773 ; ssc-mir-24-2.1-201; exon 1
Clustered miRNAs
< 10kb from ssc-mir-24-2
ssc-mir-23bchr10: 31341114-31341193 [-]
ssc-mir-27bchr10: 31340880-31340959 [-]
ssc-mir-24-2chr10: 31340334-31340413 [-]
Database links

Mature sequence ssc-miR-24-2-5p

Accession MIMAT0026468
Sequence

14 - 

gugccuacugagcugauaucagu

 - 36

Get sequence
Deep sequencing76 reads, 13 experiments
Evidence not experimental

Mature sequence ssc-miR-24-3p

Accession MIMAT0002134
Previous IDsssc-miR-24
Sequence

52 - 

uggcucaguucagcaggaacag

 - 73

Get sequence
Deep sequencing71534 reads, 15 experiments
Evidence experimental; Illumina [1,3-4], cloned [2]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
4
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).