Stem-loop sequence ssc-mir-27b

AccessionMI0013109 (change log)
DescriptionSus scrofa miR-27b stem-loop
Gene family MIPF0000036; mir-27
Literature search

32 open access papers mention ssc-mir-27b
(87 sentences)

Stem-loop
   -acg                  auug        ugac     
5'     aggugcagagcuuagcug    gugaacag    uggu 
       ||||||||||||||||||    ||||||||    ||| u
3'     uccacgucuugaaucggu    cacuuguu    gccu 
   gaag                  --ga        --uc     
Get sequence
Deep sequencing
71157 reads, 1.42e+04 reads per million, 15 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr10: 31340880-31340959 [-]
sense
ENSSSCT00000020954 ; ssc-mir-27b.1-201; exon 1
Clustered miRNAs
< 10kb from ssc-mir-27b
ssc-mir-23bchr10: 31341114-31341193 [-]
ssc-mir-27bchr10: 31340880-31340959 [-]
ssc-mir-24-2chr10: 31340334-31340413 [-]
Database links

Mature sequence ssc-miR-27b-5p

Accession MIMAT0013889
Previous IDsssc-miR-27b*
Sequence

10 - 

agagcuuagcugauuggugaaca

 - 32

Get sequence
Deep sequencing105 reads, 13 experiments
Evidence experimental; Illumina [1,3-4]

Mature sequence ssc-miR-27b-3p

Accession MIMAT0013890
Previous IDsssc-miR-27b
Sequence

52 - 

uucacaguggcuaaguucugc

 - 72

Get sequence
Deep sequencing71049 reads, 15 experiments
Evidence experimental; Illumina [1,3-4], cloned [2]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
4
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).