Stem-loop sequence ssc-mir-181d

AccessionMI0013108 (change log)
DescriptionSus scrofa miR-181d stem-loop
Gene family MIPF0000007; mir-181
Literature search

26 open access papers mention ssc-mir-181d
(52 sentences)

Stem-loop
   ----     auca         g ug          g  a a g 
5'     ucaca    acauucauu u  ucgguggguu ug g c g
       |||||    ||||||||| |  |||||||||| || | |  
3'     ggugu    uguaaguag g  agccacccag ac c g a
   gguc     -cac         g --          -  - - g 
Get sequence
Deep sequencing
695 reads, 26.7 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr2: 65553487-65553566 [-]
intergenic
Clustered miRNAs
< 10kb from ssc-mir-181d
ssc-mir-181cchr2: 65553664-65553750 [-]
ssc-mir-181dchr2: 65553487-65553566 [-]
Database links

Mature sequence ssc-miR-181d-5p

Accession MIMAT0013888
Previous IDsssc-miR-181d
Sequence

9 - 

aacauucauuguugucgguggguu

 - 32

Get sequence
Deep sequencing692 reads, 15 experiments
Evidence experimental; Illumina [1-4]

Mature sequence ssc-miR-181d-3p

Accession MIMAT0017375
Sequence

50 - 

cccaccgagggaugaaugucac

 - 71

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [2-3]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:20433717 "Deciphering the porcine intestinal microRNA transcriptome" Sharbati S, Friedlander MR, Sharbati J, Hoeke L, Chen W, Keller A, Stahler PF, Rajewsky N, Einspanier R BMC Genomics. 11:275(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
4
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).