Stem-loop sequence ssc-mir-181b-1

AccessionMI0013107 (change log)
DescriptionSus scrofa miR-181b-1 stem-loop
Gene family MIPF0000007; mir-181
Literature search

25 open access papers mention ssc-mir-181b-1
(47 sentences)

Stem-loop
   -       aucaa         cug          gaa  g 
5'  ggucaca     cauucauug   ucgguggguu   cu u
    |||||||     |||||||||   ||||||||||   ||  
3'  ccggugu     guaaguaac   agucacucga   ga g
   c       -caac         --a          aca  u 
Get sequence
Deep sequencing
2370 reads, 220 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr10: 26426857-26426936 [-]
intergenic
Clustered miRNAs
< 10kb from ssc-mir-181b-1
ssc-mir-181a-1chr10: 26427018-26427121 [-]
ssc-mir-181b-1chr10: 26426857-26426936 [-]
Database links

Mature sequence ssc-miR-181b

Accession MIMAT0002126
Sequence

11 - 

aacauucauugcugucgguggguu

 - 34

Get sequence
Deep sequencing3394 reads, 15 experiments
Evidence experimental; Illumina [1-3]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
3
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).