Stem-loop sequence ssc-mir-181a-2

Accession MI0013106
Description Sus scrofa miR-181a-2 stem-loop
Gene family MIPF0000007; mir-181
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-181_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology miR-181 microRNA precursor is a small non-coding RNA molecule. MicroRNAs (miRNAs) are transcribed as ~70 nucleotide precursors and subsequently processed by the RNase-III type enzyme Dicer to give a ~22 nucleotide mature product. In this case the mature sequence comes from the 5' arm of the precursor. They target and modulate protein expression by inhibiting translation and / or inducing degradation of target messenger RNAs. This new class of genes has recently been shown to play a central role in malignant transformation. miRNA are downregulated in many tumors and thus appear to function as tumor suppressor genes. The mature products miR-181a, miR-181b, miR-181c or miR-181d are thought to have regulatory roles at posttranscriptional level, through complementarity to target mRNAs. miR-181 which has been predicted or experimentally confirmed in a wide number of vertebrate species as rat, zebrafish, and in the pufferfish (see below) (MIPF0000007).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
----         a   u      cu       a    ggga 
    acuccaagg aca ucaacg  gucggug guuu    u
    ||||||||| ||| ||||||  ||||||| ||||    u
    ugggguucc ugu aguugc  cagccac caaa    u
uucu         a   c      --       -    aaag 
Get sequence
Genome context
Coordinates (Sscrofa9) Overlapping transcripts
1: 280334006-280334085 [+]
antisense
ENSSSCT00000006144 ; F1SKS8_PIG; intron 1
ENSSSCT00000006145 ; F1SKS7_PIG; intron 2
Clustered miRNAs
< 10kb from ssc-mir-181a-2
ssc-mir-181a-2 1: 280334006-280334085 [+]
ssc-mir-181b-2 1: 280335868-280335953 [+]
Database links

Mature sequence ssc-miR-181a

Accession MIMAT0010191
Sequence

10 - 

aacauucaacgcugucggugaguu

 - 33

Get sequence
Evidence experimental; Solexa [1,3], cloned [2]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim do H, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).