Stem-loop sequence ssc-mir-181a-2

AccessionMI0013106 (change log)
DescriptionSus scrofa miR-181a-2 stem-loop
Gene family MIPF0000007; mir-181
Literature search

33 open access papers mention ssc-mir-181a-2
(173 sentences)

Stem-loop
   ----         a   u      cu       a    ggga 
5'     acuccaagg aca ucaacg  gucggug guuu    u
       ||||||||| ||| ||||||  ||||||| ||||    u
3'     ugggguucc ugu aguugc  cagccac caaa    u
   uucu         a   c      --       -    aaag 
Get sequence
Deep sequencing
40941 reads, 9.11e+03 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr1: 299322152-299322231 [+]
antisense
ENSSSCT00000029437 ; NR6A1-201; intron 2
Clustered miRNAs
< 10kb from ssc-mir-181a-2
ssc-mir-181a-2chr1: 299322152-299322231 [+]
ssc-mir-181b-2chr1: 299324014-299324099 [+]
Database links

Mature sequence ssc-miR-181a

Accession MIMAT0010191
Sequence

10 - 

aacauucaacgcugucggugaguu

 - 33

Get sequence
Deep sequencing86411 reads, 15 experiments
Evidence experimental; Illumina [1,3-4], cloned [2]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
4
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).