Stem-loop sequence ssc-mir-103-2

AccessionMI0013105 (change log)
DescriptionSus scrofa miR-103-2 stem-loop
Gene family MIPF0000024; mir-103
Literature search

25 open access papers mention ssc-mir-103-2
(68 sentences)

Stem-loop
   ----u  g      --   u  u           ----    ua 
5'      gu cuuuca  gcu cu uacagugcugc    cuug  g
        || ||||||  ||| || |||||||||||    ||||  c
3'      ca gaaagu  cgg ga auguuacgacg    ggac  a
   agaau  a      au   -  c           aacu    uu 
Get sequence
Deep sequencing
20780 reads, 3.59e+03 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr17: 36149787-36149866 [-]
sense
ENSSSCT00000007814 ; PANK2-201; intron 5
Database links

Mature sequence ssc-miR-103

Accession MIMAT0002154
Sequence

47 - 

agcagcauuguacagggcuauga

 - 69

Get sequence
Deep sequencing41499 reads, 15 experiments
Evidence experimental; Illumina [1,3-4], cloned [2]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
4
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).