Stem-loop sequence ssc-mir-152

Accession

MI0013104

Description

Sus scrofa miR-152 stem-loop

Gene family

MIPF0000056; mir-148

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-148/mir-152_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

In molecular biology, miR-148 is a microRNA whose expression has been demonstrated in human (MI0000253), mouse (MI0000550), rat (MI0000616) and zebrafish (MI0002015). miR-148 has also been predicted in chicken (MI0001189). These predicted hairpin precursor sequence are related to those of miR-152, which has been expressed in mouse (MI0000174) and is predicted in human (MI0000462). The hairpin precursors (represented here) are predicted based on base pairing and cross-species conservation; their extents are not known. In this case, the mature sequence is excised from the 3' arm of the hairpin.

Stem-loop

-----------c              g  a    cc    cgg   c 
            ggcccagguucugu au cacu  gacu   gcu u
            |||||||||||||| || ||||  ||||   |||  
            ccggguucaagaca ua guga  cuga   cga g
uuccaggcaggc              g  c    --    ---   g 

Genome context

• Coordinates (Sscrofa9): 12: 21743215-21743294 [+]
• Overlapping transcripts:

  sense

  ENSSSCT00000020507 ; exon 1

Database links

• ENTREZGENE: 100498762;MIR152

Mature sequence ssc-miR-152

• Accession: MIMAT0013887
• Sequence: 45 - ucagugcaugacagaacuugg - 65
• Evidence: experimental; Solexa [1,3], cloned [2]

References

1. PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2. PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim do H, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
3. PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).