Stem-loop sequence ssc-mir-152

AccessionMI0013104 (change log)
DescriptionSus scrofa miR-152 stem-loop
Gene family MIPF0000056; mir-148
Literature search

12 open access papers mention ssc-mir-152
(26 sentences)

Stem-loop
   -----------c              g  a    cc    cgg   c 
5'             ggcccagguucugu au cacu  gacu   gcu u
               |||||||||||||| || ||||  ||||   |||  
3'             ccggguucaagaca ua guga  cuga   cga g
   uuccaggcaggc              g  c    --    ---   g 
Get sequence
Deep sequencing
35402 reads, 9.1e+03 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr12: 24289536-24289615 [-]
sense
ENSSSCT00000019080 ; COPZ2-201; intron 1
ENSSSCT00000020507 ; ssc-mir-152.1-201; exon 1
Database links

Mature sequence ssc-miR-152

Accession MIMAT0013887
Sequence

45 - 

ucagugcaugacagaacuugg

 - 65

Get sequence
Deep sequencing35381 reads, 15 experiments
Evidence experimental; Illumina [1,3-4], cloned [2]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
4
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).