Stem-loop sequence ssc-mir-486-1

AccessionMI0013103 (change log)
Previous IDsssc-mir-486
DescriptionSus scrofa miR-486-1 stem-loop
Gene family MIPF0000220; mir-486
Literature search

12 open access papers mention ssc-mir-486-1
(25 sentences)

Stem-loop
   -----gcu        a    c       -  cucu     cc 
5'         ggggcuuc gggc agcucgg ac    gaccu  c
           |||||||| |||| ||||||| ||    |||||  u
3'         ucccggag cccg ucgaguc ug    cuggg  g
   cgugucac        c    -       a  --uc     ca 
Get sequence
Deep sequencing
6291 reads, 1.4e+03 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr17: 12191266-12191345 [-]
sense
ENSSSCT00000020052 ; ssc-mir-486-2.1-201; exon 1
ENSSSCT00000007691 ; ANK1-201; intron 42
Database links

Mature sequence ssc-miR-486

Accession MIMAT0013886
Sequence

46 - 

uccuguacugagcugccccgag

 - 67

Get sequence
Deep sequencing12582 reads, 15 experiments
Evidence experimental; Illumina [1-2]

References

1
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
2
PMID:20180025 "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue" Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS Mol Biol Rep. 37:3567-3574(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
4
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).